- Volume 67, Issue 6, 1986
Volume 67, Issue 6, 1986
- Review Article
-
-
-
Is Rodent Virus Contamination of Monoclonal Antibody Preparations for Use in Human Therapy a Hazard?
More LessSince the discovery of monoclonal antibodies (Köhler & Milstein, 1975) much attention has been devoted to the development of reagents which would be of use in the detection and treatment of diseases, such as cancer and graft-versus-host disease resulting from human bone marrow allografts. This means that such antibodies are and will increasingly be used either in vivo in patients (Mathieu et al., 1984) or that cells from patients will be exposed to such antibodies for cytotoxic separation procedures prior to replacement into patients (Waldmann et al., 1984). As most large-scale productions of monoclonal antibodies are carried out using ascites preparations induced in either mice or rats, a question which needs careful consideration is whether rodent viruses which contaminate many colonies of laboratory animals and may contaminate hybridomas, will be present in such therapeutically used materials and, if so, whether they constitute an additional pathological threat to the patients undergoing therapy.
-
-
- Bacterial
-
-
-
DNA Inversion in Bacteriophage Mu: Characterization of the Inversion Site
More LessSummaryGin-mediated site-specific recombination promotes inversion of the G segment of phage Mu. The crossover takes place between two 34 bp-long inverted repeat sequences flanking the G segment. We have characterized the inversion site, the target for the site-specific recombination mechanism. An artificial invertible segment was constructed which consists of parts of the invertible segments of Mu and phage P1, which in this respect are largely homologous. Upon inversion of this hybrid segment the crossover site could be located, by DNA sequencing, in the ACCT sequence of the centre of symmetry in the inverted repeat in Mu. The hybrid Mu-P1 segment inverts at a lower frequency than its parental invertible segments probably because of the mismatches between the inverted repeats of Mu and P1. This suggests that base pairing between the inverted repeats is an intermediate step in recombination. Plasmids with subcloned G segments lacking the adjacent β region of Mu or the corresponding region in P7, a relative of P1, are deficient in inversion. By analysis through site-specific mutagenesis of Mu DNA, an enhancer element with multiple recognition sites was identified which is necessary for efficient inversion. This component of the inversion site was located in a 170 bp segment within the Mu β region, 30 bp to the right of the inverted repeat sequence, but can be separated from the crossover site by a 1200 bp insertion without losing its effect.
-
-
- Animal
-
-
-
Murine Pneumonia Virus: Seroepidemiological Evidence of Widespread Human Infection
More LessSummaryMore than 75% of a random sample of adult human sera exhibited moderate to high murine pneumonia virus (PVM)-neutralizing activity. There was no correlation between PVM-neutralizing activity and respiratory syncytial virus or parainfluenza type 3 virus-neutralizing activities of the same sera. In children the proportion of sera with moderate to high titres increased with age, indicating early exposure to infection. Seroconversion (i.e. > fourfold increase in titre) was observed in four of 108 paired samples of previously undiagnosed respiratory infections. These observations suggest that the human population is frequently exposed to infection with PVM or an antigenically related virus. The sera of patients suffering from Paget's disease of bone tended to exhibit higher than normal PVM-neutralizing titres in comparison with the sera of patients with other bone diseases. Thus, PVM (or an antigenically related virus) resembles some other parainfluenza viruses in being circumstantially associated with Paget's disease of bone.
-
-
-
-
Antigenic Mapping of an Avian H1 Influenza Virus Haemagglutinin and Interrelationships of H1 Viruses from Humans, Pigs and Birds
More LessSummaryMonoclonal antibodies to the haemagglutinin (HA) of the avian H1 influenza virus A/duck/Alberta/35/76 were used to construct an operational antigenic map of the HA molecule and to study the interrelationships of H1 viruses from different hosts. Haemagglutination inhibition tests between the monoclonal antibodies and variants selected by them provided evidence of four antigenic regions which overlap to varying degrees. Avian H1 influenza viruses displayed a spectrum of reactivities to the monoclonal antibody panel. Representatives of the epidemic strains of human H1 influenza viruses and early swine influenza viruses showed little or no reactivity with the monoclonal antibodies but swine influenza-like viruses isolated from pigs and humans in the last decade reacted with 11 of 17 antibodies. The antigenic similarity of these viruses to many avian isolates suggests that there has been a transfer of HA genetic information between mammalian and avian H1 influenza viruses.
-
-
-
Pathogenicity and Persistence of Pleural Effusion Disease Virus Isolates in Rabbits
More LessSummaryNine isolates of pleural effusion disease agent or virus (PEDV) from treponema-infected rabbits in various countries were examined for pathogenicity and persistence in rabbits. The isolates showed a wide range of pathogenicity and were categorized into three groups according to the severity of the acute infection. Group 1 comprised isolates causing more than 50% mortality, group 2 isolates causing mortality below 50%, while group 3 comprised isolates causing almost subclinical infections. The range between group 1 and group 3 was similar to that observed with virulent and avirulent progeny of the original PEDV isolate. Infection by each of the nine isolates resulted in a chronic low level viraemia which persisted for up to 2 years or more. Viral progeny of pathogenic isolates obtained in serum after the 2nd month of infection failed to induce clinical disease on rabbit inoculation. The chronic, subclinical infection was associated with a moderate, continued increase in serum IgG, but circulating immune complexes could not be demonstrated. Two years after infection slight histopathological changes were present in lymph nodes, spleen, liver, heart and lung. Evidence of immune complex disease could not be demonstrated.
-
-
-
An Analysis of the Biological Properties of Monoclonal Antibodies against Glycoprotein D of Herpes Simplex Virus and Identification of Amino Acid Substitutions that Confer Resistance to Neutralization
More LessSummaryFour monoclonal antibodies to glycoprotein D (gD) of herpes simplex virus (HSV) types 1 and 2 neutralized virus in the presence of complement but exhibited diverse activities in its absence. Amino acid substitutions that conferred resistance to neutralization by each antibody were identified by deriving the nucleotide sequence of the gD gene from resistant mutants. Each antibody selected a substitution from different parts of the molecule and mutants resistant to a single antibody always arose from the same mutation. One of the antibodies reacted with a synthetic oligopeptide corresponding to the region of the molecule in which amino acid substitution conferred resistance, but the remaining three antibodies failed to react with predicted oligopeptide targets. These antibodies may therefore react with ‘discontinuous’ epitopes, a view supported by the observation that two of these three antibodies competed with each other in binding assays despite the fact that substitutions conferring resistance to neutralization arose nearly 100 residues apart in the primary sequence. The four antibodies had very different biological properties. One antibody neutralized infectivity but did not inhibit cell fusion, one antibody inhibited cell fusion but did not neutralize, while a third antibody had both activities. One antibody had neither activity but enhanced the infectivity of HSV-2 in a type-specific manner. The ability of antibodies to inhibit cell fusion by syncytial virus strains correlated with an ability to prevent plaque enlargement by a non-syncytial virus strain, implying a role for gD in the intercellular spread of virus that is independent of the syncytial phenotype. We found no correlation between neutralizing activity and anti-fusion activity suggesting that, while gD is involved in cell fusion, it has at least one other function which is required for infectivity.
-
-
-
Suppression and Enhancement of Humoral Antibody Formation by Herpes Simplex Virus Types 1 and 2
S. Nick, P. Kampe, A. Knoblich, B. Metzger and D. FalkeSummaryIntraperitoneal infection of mice and rats by herpes simplex virus type 2 (HSV-2) but not type 1 (HSV-1) resulted in suppression of antibody formation on subsequent challenge with HSV-1 or HSV-2. Application of silica considerably enhanced antibody formation after primary HSV-1 infection, but only slightly after primary HSV-2 infection. Suppression induced by HSV-2 was, however, reduced significantly by injection of silica 21 days later, on the day of the second injection of HSV-2. Suppression could be detected soon after infection by HSV-2. The degree of this suppression depended on the dose of the injected virus and was abolished by u.v. irradiation of the virus prior to inoculation. Likewise the weak antibody response induced by HSV-2 was abolished for both neutralizing and ELISA antibodies. Infections with HSV-1 evoked considerable numbers of HSV-specific antibody-producing B cells, when assessed by an enzyme-linked immunospot assay. The B cell response to HSV-2, however, was very weak. Silica considerably enhanced the number of specific antibody-producing B cells only during primary HSV-1 infections. The present results in combination with earlier data demonstrate the central role of macrophages, which seem to be the primary target affected by silica, for enhancement and suppression of HSV-induced antibody generation.
-
-
-
X-Linkage of the Early in vitro α/β Interferon Response of Mouse Peritoneal Macrophages to Herpes Simplex Virus Type 2
More LessSummaryThe genetics of the early interferon response of mouse peritoneal cells to infection with herpes simplex virus type 2 (HSV-2) was studied in susceptible BALB/c and more resistant C57BL/6 mice and in reciprocal crosses between these mice. Wash-outs of the peritoneal cavity of normal C57BL/6 mice contained significantly more cells than wash-outs from BALB/c mice. Therefore, interferon induction with HSV-2 was studied under standardized conditions in vitro. Peritoneal cells reacted to HSV-2 infection by interferon production in a virus dose-dependent manner. Interferon was detected first after 2 h and peaked after 24 h. Cells from C57BL/6 mice of each sex produced significantly more early interferon than cells from BALB/c mice, and cells from female BALB/c mice produced more interferon than cells from males. This difference was not seen with C57BL/6 mice. Cultures of highly purified adherent cells yielded approximately 10 times as much interferon as cultures of non-adherent cells. Since treatment of cells with carbonyl iron and silica significantly reduced the amount of interferon produced, whereas 2000 rad of irradiation had no obvious effect, it is concluded that the main interferon-producing cell in the peritoneal cavity of mice in response to HSV-2 is of the monocyte/macrophage lineage. Interferon production in peritoneal cells was found to be quantitatively influenced by X-linked loci in that cells from male (BALB/c female × C57 male) F1 mice, which inherit the X chromosome from the low-responding BALB/c females, produced significantly lower amounts of interferon than cells from the other three F1 generation genotypes. All interferons were characterized as α/β interferon. It is suggested that the early production of α/β interferon in response to HSV-2 is influenced by X-linked loci, which might be involved in sex-linked differences in resistance to human herpesviruses.
-
-
-
Conversion of a Fraction of the Unique Sequence to Part of the Inverted Repeats in the S Component of the Herpes Simplex Virus Type 1 Genome
More LessSummaryA novel genome variant of herpes simplex virus type 1 (HSV-1) was isolated, in the S component of which a fraction of the unique sequence (map units 0.865 to 0.880) was converted to part of the diploid inverted repeats and another fraction of the unique sequence (map units 0.937 to 0.955) had been deleted. The S component of the variant consisted of a shortened unique sequence (map units 0.880 to 0.937) and a pair of elongated inverted repeats (map units 0.820 to 0.880, and 0.937 to 1.000). The conversion occurred as a result of a recombination event between two points (map units 0.880 and 0.937) having a 5 base pair stretch (5′-CCCCG-3′) of homology, in an inverted direction in the unique sequence. An involvement of the mechanism causing L-S inversion was inferred to account for the generation of the variant, as there are multiple copies of the 5′-CCCCG-3′ stretch in the ‘a’ sequences. The occurrence of the variant indicates that the products of HSV-1 genes US9, US10, US11 and US12 are unnecessary for an HSV-1 productive infection in tissue culture cells, and also suggests the presence of a mechanism whereby expansion of the inverted repeats could occur.
-
-
-
Characteristics of the Induction of a New Protein Kinase in Cells Infected with Herpesviruses
More LessSummaryThe appearance of a recently described protein kinase activity (virus-induced protein kinase, ViPK) has been studied during infection of hamster fibroblasts with pseudorabies virus or with herpes simplex virus type 1 (HSV-1). An enzyme activity with comparable catalytic properties was induced in both cases, and had broadly similar kinetics of appearance to that of the viral DNA polymerase. The amount of active ViPK detected depended on the multiplicity of infection, and no ViPK was induced after the viruses had been subjected to irradiation with u.v. light. When cells were infected with the tsK mutant of HSV-1, ViPK was induced at the permissive but not at the restrictive temperature. The ViPK preparations obtained from cells infected with each virus differed in chromatographic properties on anion-exchange and gelpermeation resins. These results indicate that expression of the viral genome is required for induction of ViPK. They suggest that the enzyme may be encoded by the viral genome, but do not provide proof of this.
-
-
-
The Purification and Characterization of Rat Gamma Interferon by Use of Two Monoclonal Antibodies
More LessSummaryTwo mouse monoclonal antibodies, designated DB-1 and DB-2, were isolated and used for the purification and characterization of recombinant rat interferon gamma (rRIF-γ) derived from Chinese hamster ovary (CHO) cells. The two antibodies belong to different classes (DB-1 is an IgG1 and DB-2 an IgA) and display similar epitope specificities as shown in competition binding experiments. Both antibodies, raised against rRIF-γ, exhibited high affinity for rat and mouse gamma interferon and efficiently neutralized the antiviral activity of both animal interferon species. Affinity chromatography analysis showed that a column with immobilized DB-1 was capable of complete binding of rat and mouse gamma interferon, both natural and recombinant DNA-derived. As visualized by SDS-polyacrylamide gel electrophoresis and Western blot analysis, the purified rRIF-γ preparation consisted of at least seven molecular forms with M r values ranging between 14000 and 25000, with a relative abundance of a 18000 M r protein. Gel permeation chromatography of crude rRIF-γ gave coincident peaks of rRIF-γ proteins (all different forms) and interferon activity corresponding to a M r value of 45000. The results suggest that the molecular heterogeneity was due to differential glycosylation and was not the consequence of a proteolytic degradation process.
-
-
-
Location and Nucleotide Sequence of the Orgyia pseudotsugata Single Nucleocapsid Nuclear Polyhedrosis Virus Polyhedrin Gene
More LessSummaryA restriction endonuclease map was determined for the Orgyia pseudotsugata single nucleocapsid nuclear polyhedrosis virus (SNPV) genome. The order of the fragments generated by the enzymes Bg/II, BamHI and XbaI was analysed using double digestion of the total genome and digestion of isolated restriction fragments. The location of the polyhedrin gene was then determined using a cloned polyhedrin gene from the O. pseudotsugata multiple nucleocapsid NPV (MNPV) as a hybridization probe. A fragment containing this gene was cloned, mapped, subcloned and the nucleotide sequence of a 1.3 kb fragment was determined which contained the entire polyhedrin reading frame and some flanking sequences. This gene demonstrated 76% nucleotide sequence homology and 87% amino acid sequence homology to the Autographa californica MNPV polyhedrin sequence. A probable regulatory element was identified which is common to the 5′ flanking region of all hypertranscribed late genes (polyhedrin and 10K proteins) which have been examined in baculoviruses.
-
-
-
Identification and Characterization of Bahia Grande, Reed Ranch and Muir Springs Viruses, Related Members of the Family Rhabdoviridae with Widespread Distribution in the United States
More LessSummarySixteen virus isolates with similar biological characteristics were obtained from saltmarsh mosquitoes collected in south Texas in 1974. When compared antigenically, these and 13 other isolates from mosquitoes collected between 1972 and 1979 in west Texas, New Mexico, Louisiana, Colorado and North Dakota were shown to be related but not identical. Three distinct serotypes were determined: Bahia Grande (prototype strain TB4-1054), Reed Ranch (TB4-222) and Muir Springs (76V-23524). When examined by electron microscopy, these three viruses were shown to be rhabdoviruses. Structural analysis of the prototype strain of Bahia Grande virus from Texas revealed five proteins. Comparative oligonucleotide fingerprint maps showed 51 to 86% sharing of the large oligonucleotides between Bahia Grande virus (strain TB4-1054) and 11 other antigenically related isolates but not with Muir Springs virus (strain 76V-23524) an antigenically distinct isolate from mosquitoes collected in Colorado. A serological survey for antibody to Bahia Grande virus showed that humans, cattle, sheep, reptiles and wild mammals from south Texas had neutralizing antibodies to this virus.
-
-
-
Infection of Cultured Early Mouse Embryos with Semliki Forest and Rubella Viruses
More LessSummaryEarly mouse embryos at the four- to eight-cell stage or the blastocyst stage could be infected with the A7 strain of Semliki Forest virus (SFV) after the removal of the zona pellucida, either by Pronase treatment or following hatching of blastocysts. With SFV, rapid virus production and eventual cytolysis resulted from infection at either stage. Four four- to eight-cell embryos the cytopathic effect was delayed and a proportion of embryos developed to the blastocyst stage. Four- and eight-cell embryos could not be infected with rubella virus (RV), even after removal of the zona pellucida. RV infection of zona-free blastocysts resulted in a productive but non-cytolytic infection which did not affect embryonic development to the early egg-cylinder stage. RV did not multiply in inner cell mass cells isolated from embryos at the blastocyst stage, although SFV did multiply in such cells.
-
-
-
The Murine Antibody Response to Lactate Dehydrogenase-elevating Virus
More LessSummaryMice infected with lactate dehydrogenase-elevating virus (LDV) were found to produce high titres of IgG anti-LDV antibodies that remained elevated for more than 1 year. This response, which was T-dependent, showed a striking preponderance of IgG2a with, from one strain to another, variable proportions of IgG2b and IgG3 but always very little IgG1. The binding of these antibodies to viral protein blots showed a major reaction with VP3, the heterogeneous glycosylated material of the viral envelope. A minor reaction was also noted with VP1, the nucleocapsid protein, but no antibodies were detected against VP2, the non-glycosylated envelope protein of LDV. A similar preponderance of anti-VP3 antibodies was also observed in a large set of anti-LDV hybridomas. Analysis of VP3 with monoclonal antibodies suggested that, despite its heterogeneity, this material has a common polypeptide moiety that apparently carries two major epitopes.
-
-
-
Chronic Infection of Nude Mice by Murine K Papovavirus
More LessSummaryNude (nu/nu) mice were inoculated intracranially with 106.5 newborn mouse 50% lethal doses of K virus and were studied over a period of 28 weeks using serological methods, virus assay and immunohistological staining for viral antigens. K virus infection of nude mice, although clinically asymptomatic, was slowly progressive despite prompt IgM and IgG antibody response. The highest titres of K virus infectivity were reached in spleens, kidneys and intestines. Vascular endothelial cells represented the major site of viral replication, as has been shown to be the case in immunologically normal mice, with extensive involvement of intestinal capillaries. In addition, however, unlike immunologically normal mice, nude mice inoculated with K virus developed multifocal infection of renal tubular epithelial cells. Nude mice did not develop histologically detectable evidence of central nervous system involvement by K virus, and K virus infection did not result in neoplasia. Infected vascular endothelial cells and renal tubular epithelial cells in animals studied at 16 and 27 weeks after inoculation were grouped in scattered clusters, suggesting local spread of infection. The present study indicates that nude mice with preserved B cell function but impaired T cell-mediated immunity are able to limit systemic dissemination of K virus but are unable to prevent local progression of infection by cell-to-cell spread. K virus is capable of altering its cellular tropism during chronic infection.
-
-
-
Haemagglutinin of Influenza A Virus Is a Target for the Antiviral Effect of NorakinR
More LessSummaryThe anticholinergic anti-parkinsonism drug NorakinR is an inhibitor of influenza virus multiplication. By crossing a Norakin-resistant variant of fowl plague virus (FPV) strain Weybridge with the sensitive FPV/Rostock/34 wild-type virus, Norakin-resistant recombinants were obtained. Analyses of the gene composition showed that all Norakin-resistant recombinants had inherited their haemagglutinin gene from the Norakin-resistant parent strain. The majority of the recombinants had received all the other gene segments from the sensitive parent strain. Norakin was shown to inhibit red blood cell lysis induced either by purified virions or by the haemagglutinin of a sensitive FPV strain at low pH, but failed to affect the Norakin-resistant FPV variant. No aggregation of autoliposomes containing the haemagglutinin of a sensitive FPV strain or digestion of the HA1 subunit of haemagglutinin by trypsin occurred in the presence of Norakin at acid pH. The data suggest that the haemagglutinin of FPV is the target for the antiviral activity of Norakin, which acts by inhibiting the conformational change in the haemagglutinin at acid pH important for lysis.
-
-
-
The Herpes Simplex Virus Type 2 Alkaline DNase Activity Is Essential for Replication and Growth
More LessSummaryA mutant of herpes simplex virus type 2 (HSV-2), which is temperature-sensitive (ts) for the induction of an alkaline DNase activity, was examined at a number of different temperatures. Induction of DNase activity by this mutant resembled that of wild-type (wt) virus at 31 °C but was greatly reduced at 38.5 °C and barely detectable at 39.2 °C. Virus DNA synthesis showed similar patterns, exhibiting wt levels at 31 °C, reduced levels at 38.5 °C and very little incorporation at 39.2 °C. Similarly, virus growth in cells infected with this mutant was equal to that of wt at 31 °C, slightly reduced at 38.5 °C but considerably reduced at 39.2 °C. Marker rescue of the ts DNase lesion restored wt levels of virus DNase activity, of virus DNA synthesis and of virus growth, thus providing direct evidence that HSV DNase activity is essential for virus replication.
-
-
-
Differentiation of Serum Antibodies from Pigs Vaccinated or Infected with Aujeszky's Disease Virus by a Competitive Enzyme Immunoassay
More LessSummaryA competitive enzyme immunoassay was developed to detect antibodies to a glycoprotein (gI) of Aujeszky's disease virus. Infected cell monolayers were used as antigen and a monoclonal antibody directed against an epitope of gI as indicator antibody. It was demonstrated that pigs vaccinated with the Bartha, BUK or NIA-4 strains did not produce antibody to the epitope of gI, whereas all wild-type viruses tested did induce this antibody. The antibody to the gI epitope persisted for at least 15 weeks. The present test, which enables us to distinguish pigs vaccinated with certain attenuated strains from pigs infected with wild-type Aujeszky's disease virus, may be of great value in future combined vaccination-eradication programmes for Aujeszky's disease.
-
-
-
Analysis of Structural Properties which Possibly Are Characteristic for the 3′-Terminal Sequence of the Genome RNA of Flaviviruses
G. Wengler and E. CastleSummaryRecently we have shown that an open reading frame comprising 10290 nucleotides is present on the infectious, single-stranded genome RNA of the West Nile flavivirus. We have now isolated cloned cDNA representing the 3′-terminal untranslated region of this molecule. The sequence of this region which comprises 571 nucleotides is given in this report. Recently, the nucleotide sequence of the genome RNA of the yellow fever flavivirus has been described. A comparative analysis of the 3′-terminal untranslated nucleotide sequences present in each genome suggests that in flaviviruses this region probably has the following properties. It has a heteropolymeric sequence at the 3′ terminus. It contains one or more oligonucleotide sequences that are repeated. An extensive stem and loop structure can be folded from the nucleotide sequences present at the 3′ terminus. The stem of this structure contains a conserved region introducing a defined mismatch into the stem. The loop of this structure probably contains short conserved oligonucleotide sequences in analogous positions. In both viruses the oligonucleotide CAUAUUGAC (A G)CC(U A GGGA(U A AGAC lies closely in front of the sequence which can be folded into the stem of the 3′-terminal stem and loop structure and the oligonucleotide CUAGAGGUUAGAGGAGACCC is strictly conserved between both viruses. The analyses indicate that the 3′-terminal untranslated region of the genome of flaviviruses probably has rather unique characteristics of primary and secondary structure. Possible implications of these findings are discussed.
-
-
-
Persistence of Virulent Semliki Forest Virus in Mouse Brain Following Co-inoculation with Defective Interfering Particles
More LessSummarySemliki Forest virus (SFV) normally causes an acute lethal encephalitis in mice following intranasal inoculation. However, animals co-administered with 10 LD50 SFV and defective interfering (DI) SFV survive the infection without clinical signs of disease. In this report we demonstrate the isolation of infectious virus from the brains of 12/169 protected mice up to 6.5 months post-infection. Although, with one exception, mice were clinically normal, five of 12 of the SFV isolates were identical to the original virus as judged by plaque morphology, maximum temperature for growth, virulence in mice and pathology. Others were less virulent (although not any were plaque or temperature-sensitive mutants) and on re-inoculation into fresh mice caused a demyelinating pathology which was not an attribute of the original inoculum. How the virulent virus can persist in brain, sometimes in amounts in excess of 100 LD50, without causing disease remains to be determined.
-
-
-
Very Rapid Generation/Amplification of Defective Interfering Particles by Vesicular Stomatitis Virus Variants Isolated from Persistent Infection
More LessSummaryMultiply cloned variants of vesicular stomatitis virus (VSV) were found to generate/amplify defective interfering (DI) particles at a rate greatly exceeding the rates normally observed for wild-type VSV (or for other mutants of VSV). A single undiluted passage of the first clonal pool of this variant virus produced concentrated visible bands of DI particles on sucrose gradients whereas wild-type and other mutant strains of VSV required from three to six or more serial undiluted passages. Since DI particle amplication by wild-type VSV at each undiluted passage can exceed 10000-fold enrichment, these variant virus clones were generating/amplifying DI particles many millions of times more rapidly than were wild-type and other mutant strains of VSV. This rate of generation/amplification is so high that it was not feasible to obtain accurate estimates of the rates of generation (or amplification) of these DI particles.
-
-
-
Anomalous Behaviour of Newcastle Disease Virus Haemagglutinin-Neuraminidase Protein in Western Blotting Analysis of Monoclonal Antibody Binding Sites
More LessSummaryPrevious studies with a particular monoclonal antibody (MAb 445) raised against the Ulster strain of Newcastle disease virus (NDV) have shown that this MAb immune-precipitates only the 74000 mol. wt. (74K) haemagglutinin-neuraminidase protein (HN) of both Ulster and Beaudette C strains of NDV. Using the technique of Western blotting, it is shown that under certain denaturing conditions virion proteins comigrating in SDS-polyacrylamide gels with the faster migrating 67K fusion protein and 53K nucleocapsid/nucleocapsid-associated protein, as well as the 74K HN, all reacted strongly with MAb 445 and with MAb 14 which is also directed against the HN protein. Analysis of this anomalous behaviour using SDS-polyacrylamide diagonal gel electrophoresis has led to the unexpected conclusion that the 74K HN can electrophorese as three immunoreactive species of apparent mol. wt. 74K, 67K and 53K. If the Western blotting technique is to be applied to proteins which have not been sufficiently denatured (in an attempt to preserve epitope integrity) it is important to establish that no additional proteins remain associated with the protein bands that react with the MAb.
-
-
-
Binding of Murine 125I-labelled Natural Interferon-γ to Murine Cell Receptors
More LessSummaryNatural murine interferon-γ (naMuIFN-γ) produced by T-lymphoma cells (L12-R4) stimulated with phorbol myristic acetate was purified by use of an anti-MuIFN-γ immunoadsorbent and was labelled with 125I to study its binding to murine cell receptors. All the cell lines examined bound naMuIFN-γ, although the binding affinity varied considerably. By adding increasing concentrations of unlabelled naMuIFN-γ in competition binding assays we determined dissociation constants (K D) of 8.2 × 10−10 and 7.4 × 10−10 m for L1210 and TS/A cells, respectively, and of 6.5 × 10−9 m for L-929 cells. The numbers of receptors present per cell of these lines were 3000, 1000 and 2000 respectively. Highly purified naMuIFN-γ as well as recombinant MuIFN-γ competed for binding sites with 125I-labelled IFN-γ on L1210 cells, although the latter displayed a K D greater than the former (5.8 × 10−9 m compared to 8.2 × 10−10 m). Moreover, protease, but not endoglycosidase, treatment of target cells prevented the subsequent binding of 125I-labelled IFN-γ, suggesting that a protein moiety is involved in the binding of the ligand. These studies demonstrate that naMuIFN-γ binds in a specific manner and with high affinity to murine cell receptors.
-
-
-
Enhancement by Carprofen or Indomethacin of Interferon Induction by 10-Carboxymethyl-9-Acridanone in Murine Cell Cultures
More LessSummaryNon-steroidal anti-inflammatory drugs such as carprofen or indomethacin enhanced interferon (IFN) production induced by suboptimal concentrations of 10-carboxy-methyl-9-acridanone (CMA) in murine cell cultures. This effect was observed in fibroblasts and in different populations of leukocytes as in peritoneal exudate and spleen cells, and was most pronounced in bone marrow-derived macrophages. Carprofen was the most effective compound causing an up to 500-fold increase of CMA-induced IFN production in pure bone marrow-derived macrophages. In these macrophage cultures the potentiating effect on CMA-induced IFN production by carprofen and indomethacin did not depend on inhibition of cyclooxygenase.
-
- Plant
-
-
-
Kinetics of Accumulation of the Three Non-structural Proteins of Alfalfa Mosaic Virus in Tobacco Plants
More LessSummaryAntisera to synthetic peptides corresponding to the C-termini of two non-structural proteins (NSP) of alfalfa mosaic virus (AIMV), P1 (126K) and P3 (32K), were prepared and characterized. These antisera, together with one which had previously been made against the C-terminus of P2 (90K), enabled us to detect the three NSPs in a crude membrane fraction from AlMV-infected tobacco leaves. The accumulation of these proteins at 25 °C and at 10 °C was followed as a function of time after inoculation, and their amounts were compared with viral replicase activity. All three proteins accumulated at the beginning of the infection period and then disappeared, P3 more rapidly than the other two. There was a good correlation between replicase activity and the amounts of P1 and P2, but not the amount of P3. These results are consistent with the notion that P1 and P2 are part of the replication complex. Although much less coat protein was made in inoculated leaves at 10 °C than at 25 °C, the maximum amounts of the three NSPs and the maximum replicase activity were at least as high at 10 °C as at 25 °C. Thus, 10 °C is not a restrictive temperature for the assembly of a functional replication complex.
-
-
-
-
Translation of Cymbidium Ringspot Virus RNA in Cowpea Protoplasts and Rabbit Reticulocyte Lysates
More LessSummaryRNA from cymbidium ringspot virus (CyRSV), a tombusvirus, was translated in rabbit reticulocyte lysates and in vitro translation products were compared with virus-specific proteins in extracts of cowpea protoplasts inoculated with virus particles. Four major polypeptides were produced in vitro, with molecular weights of 43000 (43K), 40K, 34K and 22K, and three were produced in vivo, with molecular weights of 45K, 43K and 22K. The 43K and probably also the 22K product were the same in vitro and in vivo; the former was definitely identified as the virus coat protein. The 45K protein was a modified coat protein found only in extracts of infected protoplasts that had been frozen. Translation experiments with size-fractionated RNA indicated that the translation strategy of CyRSV RNA involved, as templates, both genome-size RNA (40K product) and subgenomic species (43K, 34K and 22K products). The presence of at least three coding regions on the virus genome was suggested by comparative peptide mapping of the four major translation products. No infection-specific polypeptides or translation products were detected as specific to satellite RNA, either in inocula for protoplasts or in RNA added to reticulocyte lysates.
-
-
-
Virus Protein Association with Cylindrical Inclusions of Two Viruses that Infect Wheat
More LessSummaryImmunoelectron microscopy with gold-labelled antibodies showed that homologous capsid proteins or virions are associated with cylindrical inclusions of wheat streak mosaic virus and of wheat spindle streak mosaic virus in vivo. Capsid proteins did not bind to any other structure in the cell. The specific association of capsid proteins with cylindrical inclusions is discussed in relation to cell-to-cell spread of virions through plasmodesmata.
-
-
-
Comparison of the Genome RNA Sequence Homologies between Isolates of Cherry Leaf Roll Virus by Complementary DNA Hybridization Analysis
More LessSummaryThe sequence homologies between the RNA genomes of seven European and one North American isolate of cherry leaf roll virus (CLRV) were compared using cDNA hybridization analysis. A high degree of homology (85 to 95%) was detected between birch and cherry isolates of the virus, but lower levels of homology (46 to 48%) were inferred when these were compared with a rhubarb or a North American dogwood isolate of CLRV.
-
Volumes and issues
-
Volume 105 (2024)
-
Volume 104 (2023)
-
Volume 103 (2022)
-
Volume 102 (2021)
-
Volume 101 (2020)
-
Volume 100 (2019)
-
Volume 99 (2018)
-
Volume 98 (2017)
-
Volume 97 (2016)
-
Volume 96 (2015)
-
Volume 95 (2014)
-
Volume 94 (2013)
-
Volume 93 (2012)
-
Volume 92 (2011)
-
Volume 91 (2010)
-
Volume 90 (2009)
-
Volume 89 (2008)
-
Volume 88 (2007)
-
Volume 87 (2006)
-
Volume 86 (2005)
-
Volume 85 (2004)
-
Volume 84 (2003)
-
Volume 83 (2002)
-
Volume 82 (2001)
-
Volume 81 (2000)
-
Volume 80 (1999)
-
Volume 79 (1998)
-
Volume 78 (1997)
-
Volume 77 (1996)
-
Volume 76 (1995)
-
Volume 75 (1994)
-
Volume 74 (1993)
-
Volume 73 (1992)
-
Volume 72 (1991)
-
Volume 71 (1990)
-
Volume 70 (1989)
-
Volume 69 (1988)
-
Volume 68 (1987)
-
Volume 67 (1986)
-
Volume 66 (1985)
-
Volume 65 (1984)
-
Volume 64 (1983)
-
Volume 63 (1982)
-
Volume 62 (1982)
-
Volume 61 (1982)
-
Volume 60 (1982)
-
Volume 59 (1982)
-
Volume 58 (1982)
-
Volume 57 (1981)
-
Volume 56 (1981)
-
Volume 55 (1981)
-
Volume 54 (1981)
-
Volume 53 (1981)
-
Volume 52 (1981)
-
Volume 51 (1980)
-
Volume 50 (1980)
-
Volume 49 (1980)
-
Volume 48 (1980)
-
Volume 47 (1980)
-
Volume 46 (1980)
-
Volume 45 (1979)
-
Volume 44 (1979)
-
Volume 43 (1979)
-
Volume 42 (1979)
-
Volume 41 (1978)
-
Volume 40 (1978)
-
Volume 39 (1978)
-
Volume 38 (1978)
-
Volume 37 (1977)
-
Volume 36 (1977)
-
Volume 35 (1977)
-
Volume 34 (1977)
-
Volume 33 (1976)
-
Volume 32 (1976)
-
Volume 31 (1976)
-
Volume 30 (1976)
-
Volume 29 (1975)
-
Volume 28 (1975)
-
Volume 27 (1975)
-
Volume 26 (1975)
-
Volume 25 (1974)
-
Volume 24 (1974)
-
Volume 23 (1974)
-
Volume 22 (1974)
-
Volume 21 (1973)
-
Volume 20 (1973)
-
Volume 19 (1973)
-
Volume 18 (1973)
-
Volume 17 (1972)
-
Volume 16 (1972)
-
Volume 15 (1972)
-
Volume 14 (1972)
-
Volume 13 (1971)
-
Volume 12 (1971)
-
Volume 11 (1971)
-
Volume 10 (1971)
-
Volume 9 (1970)
-
Volume 8 (1970)
-
Volume 7 (1970)
-
Volume 6 (1970)
-
Volume 5 (1969)
-
Volume 4 (1969)
-
Volume 3 (1968)
-
Volume 2 (1968)
-
Volume 1 (1967)